Top » Catalog » SNPs » ZS7539

$18.00

ZS7539
[ZS7539]

ZS7539
hg38 Position: ChrY:26639012..26639012
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC2. Found in Big Y sample M9881
Forward Primer: ZS7539_F TGGAATCGAATCACAAGGAAC
Reverse Primer: ZS7539_R TGTTTCAATTCACCACCTTCC
Reviews

Customers who bought this product also purchased
FGC1696
FGC1696
BY38119
BY38119
Y36224
Y36224
ZS7093
ZS7093
BY145
BY145
FGC7
FGC7
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies