Top » Catalog » SNPs » DF105

$18.00

DF105
[DF105]

DF105
hg38 Position: ChrY:12484132..12484132
Ancestral: G
Derived: A
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a
Comments: .
Forward Primer: DF105_F ACTTTCATTTCCCCAAAAGGAG
Reverse Primer: DF105_R AATTCCACTCCTAGGTATACACTCAAG
Reviews

Customers who bought this product also purchased
CTS10100
CTS10100
M284
M284
M253
M253
Y3685
Y3685
S2679
S2679
FGC15072
FGC15072
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies