Top » Catalog » SNPs » F2437

$19.00

F2437
[F2437]

F2437
hg38 Position: ChrY:15163083..15163083
Ancestral: C
Derived: T
Reference: Yan Shi (2011)
ISOGG Haplogroup: O3 (not listed)
Comments: Found in a hg O3 person. Likely a singleton.
Forward Primer: F2437_F AAACATTGTACCAGTAAGTGCACG
Reverse Primer: F2437_R GGATGGGAAATGATGTTTCTG
Reviews

Customers who bought this product also purchased
L14
L14
Z2103
Z2103
PF7562
PF7562
FGC22049
FGC22049
L48
L48
S310
S310
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies