Top » Catalog » SNPs » F2437

$18.00

F2437
[F2437]

F2437
hg38 Position: ChrY:15163083..15163083
Ancestral: C
Derived: T
Reference: Yan Shi (2011)
ISOGG Haplogroup: O3 (not listed)
Comments: Found in a hg O3 person. Likely a singleton.
Forward Primer: F2437_F AAACATTGTACCAGTAAGTGCACG
Reverse Primer: F2437_R GGATGGGAAATGATGTTTCTG
Reviews

Customers who bought this product also purchased
L14
L14
Z2103
Z2103
PF7562
PF7562
A1277
A1277
FGC5229
FGC5229
L143
L143
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies