Top » Catalog » SNPs » FTB88402

$19.00

FTB88402
[FTB88402]

FTB88402
hg38 Position: ChrY:17295707..17295708
Ancestral: ins
Derived: del
Reference: FTDNA (2023)
ISOGG Haplogroup: I1
Comments: Below A11141
Forward Primer: FTB88402_F TTTGAGTCAGGCCCATTTTC
Reverse Primer: FTB88402_R TTGTAGGGCTTTTGAGGACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies