Top » Catalog » SNPs » FGC37616

$19.00

FGC37616
[FGC37616]

FGC37616
hg38 Position: ChrY:8562479..8562479
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC37616_F GCCCCTGCAAGATGCAAG
Reverse Primer: FGC37616_R AAGGGTCCACCTCCTACACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies