Top » Catalog » SNPs » Y362133

$19.00

Y362133
[Y362133]

Y362133
hg38 Position: ChrY:15411908..15411908
Ancestral: G
Derived: C
Reference: YFull (2022)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y362133_F CAACCCCATCAAAAAGTCTGG
Reverse Primer: Y362133_R ATGTGACATGCTGGTGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies