Top » Catalog » SNPs » FGC33214

$18.00

FGC33214
[FGC33214]

FGC33214
hg38 Position: ChrY:8222189..8222189
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: M222 > DF105 > DF85 > DF97 > FGC19851 > A1147
Forward Primer: FGC33214_F CGAATGGCATTTACATGAGC
Reverse Primer: FGC33214_R ATGGCTTATAATTTTGTTTGTTCTC
Reviews

Customers who bought this product also purchased
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A259
A259
FGC30115
FGC30115
DF85
DF85
FGC19852
FGC19852
S588
S588
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies