Top » Catalog » SNPs » ZS11617

$18.00

ZS11617
[ZS11617]

ZS11617
hg38 Position: ChrY:9330298..9330298
Ancestral: T
Derived: C
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream ZS5804
Forward Primer: ZS11617_F CACAGGTTGTGTGTCCTCTCTG
Reverse Primer: ZS11617_R CCCAGCTGGTTCTTAAAGGC
Reviews

Customers who bought this product also purchased
A11957
A11957
ZS11614
ZS11614
ZS11621
ZS11621
ZS11613
ZS11613
ZS11620
ZS11620
ZS11619
ZS11619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies