Top » Catalog » SNPs » ZS11617

$18.00

ZS11617
[ZS11617]

ZS11617
hg38 Position: ChrY:9330298..9330298
Ancestral: T
Derived: C
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream ZS5804
Forward Primer: ZS11617_F CACAGGTTGTGTGTCCTCTCTG
Reverse Primer: ZS11617_R CCCAGCTGGTTCTTAAAGGC
Reviews

Customers who bought this product also purchased
ZS5806
ZS5806
M267
M267
Y16746
Y16746
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
ZS5804
ZS5804
A15552
A15552
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies