Top » Catalog » SNPs » ZS11617

$18.00

ZS11617
[ZS11617]

ZS11617
hg38 Position: ChrY:9330298..9330298
Ancestral: T
Derived: C
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream ZS5804
Forward Primer: ZS11617_F CACAGGTTGTGTGTCCTCTCTG
Reverse Primer: ZS11617_R CCCAGCTGGTTCTTAAAGGC
Reviews

Customers who bought this product also purchased
FGC40709
FGC40709
FGC34530
FGC34530
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS5809
ZS5809
ZS11666
ZS11666
ZS5814
ZS5814
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies