Top » Catalog » SNPs » ZS11617

$18.00

ZS11617
[ZS11617]

ZS11617
hg38 Position: ChrY:9330298..9330298
Ancestral: T
Derived: C
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream ZS5804
Forward Primer: ZS11617_F CACAGGTTGTGTGTCCTCTCTG
Reverse Primer: ZS11617_R CCCAGCTGGTTCTTAAAGGC
Reviews

Customers who bought this product also purchased
ZS5801
ZS5801
A13649
A13649
FGC1715
FGC1715
A19335
A19335
FGC40709
FGC40709
FGC34530
FGC34530
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies