Top » Catalog » SNPs » Z697

$18.00

Z697
[Z697]

Z697
hg38 Position: ChrY:8743712..8743712
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of Z278
Forward Primer: Z697_F TTTTCCAGGTGAAGGAGTGG
Reverse Primer: Z697_R CCTTTAGGTGGCTTGTGTGG
Reviews

Customers who bought this product also purchased
HVR2
HVR2
Z216
Z216
A4679
A4679
HVR1
HVR1
CTS4065
CTS4065
Z278
Z278
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies