Top » Catalog » SNPs » Z697

$18.00

Z697
[Z697]

Z697
hg38 Position: ChrY:8743712..8743712
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of Z278
Forward Primer: Z697_F TTTTCCAGGTGAAGGAGTGG
Reverse Primer: Z697_R CCTTTAGGTGGCTTGTGTGG
Reviews

Customers who bought this product also purchased
A24213
A24213
FGC17318
FGC17318
Z279
Z279
Z216
Z216
A4679
A4679
HVR1
HVR1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies