Top » Catalog » SNPs » Z5950

$18.00

Z5950
[Z5950]

Z5950
hg38 Position: ChrY:7132208..7132208
Ancestral: G
Derived: T
Reference: Ray Banks (2013)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a4
Comments: Downstream of U290
Forward Primer: Z5950_F TATTTAGAGTTTTTAGCAAGAAGAGTGC
Reverse Primer: Z5950_R CGGGACACATACACCCTTG
Reviews

Customers who bought this product also purchased
Z21887
Z21887
Y4008
Y4008
Z1720
Z1720
Z5952
Z5952
Z1725
Z1725
Z5955
Z5955
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies