Top » Catalog » SNPs » Z5950

$18.00

Z5950
[Z5950]

Z5950
hg38 Position: ChrY:7132208..7132208
Ancestral: G
Derived: T
Reference: Ray Banks (2013)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a4
Comments: Downstream of U290
Forward Primer: Z5950_F TATTTAGAGTTTTTAGCAAGAAGAGTGC
Reverse Primer: Z5950_R CGGGACACATACACCCTTG
Reviews

Customers who bought this product also purchased
Z1720
Z1720
Z21887
Z21887
Y4008
Y4008
E1b-U175 "Bantu Expansion" Panel
E1b-U175 "Bantu Expansion" Panel
U181
U181
Z1786
Z1786
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies