Top » Catalog » SNPs » Z5952

$15.00

Z5952
[Z5952]

Z5952
hg38 Position: ChrY:20983295..20983295
Ancestral: C
Derived: T
Reference: Ray Banks (2013)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a11
Comments: Downstream of U290
Forward Primer: Z5952_F AGTTCTAAGTTGTCTGCTTTATGTTCTC
Reverse Primer: Z5952_R GGGGTTGCAGTCCTACTCTCC
Reviews

Customers who bought this product also purchased
Y4008
Y4008
Z1720
Z1720
Z21887
Z21887
Z5955
Z5955
U290
U290
M3951
M3951
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies