Top » Catalog » SNPs » Z5952

$18.00

Z5952
[Z5952]

Z5952
hg38 Position: ChrY:20983295..20983295
Ancestral: C
Derived: T
Reference: Ray Banks (2013)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a11
Comments: Downstream of U290
Forward Primer: Z5952_F AGTTCTAAGTTGTCTGCTTTATGTTCTC
Reverse Primer: Z5952_R GGGGTTGCAGTCCTACTCTCC
Reviews

Customers who bought this product also purchased
Z1720
Z1720
Z21887
Z21887
Y4008
Y4008
U290
U290
M3951
M3951
E1b-U175 "Bantu Expansion" Panel
E1b-U175 "Bantu Expansion" Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies