Top » Catalog » SNPs » CTS10760

$18.00

CTS10760
[CTS10760]

CTS10760
hg38 Position: ChrY:20600088..20600088
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N1c (not listed)
Comments: Downstream CTS10336 > Y6058
Forward Primer: CTS10760_F TCAACATGGACACATCACATTG
Reverse Primer: CTS10760_R CATAAAAGATGTCCAAACCTTCC
Reviews

Customers who bought this product also purchased
L1025
L1025
BY158
BY158
Y62942
Y62942
M2783
M2783
L551
L551
Y155153
Y155153
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies