Top » Catalog » SNPs » CTS10760

$18.00

CTS10760
[CTS10760]

CTS10760
hg38 Position: ChrY:20600088..20600088
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N1c (not listed)
Comments: Downstream CTS10336 > Y6058
Forward Primer: CTS10760_F TCAACATGGACACATCACATTG
Reverse Primer: CTS10760_R CATAAAAGATGTCCAAACCTTCC
Reviews

Customers who bought this product also purchased
L550
L550
Z16974
Z16974
Y87014
Y87014
N1a-VL29 Panel
N1a-VL29 Panel
Z16980
Z16980
Y24076
Y24076
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies