Top » Catalog » SNPs » A5629

$18.00

A5629
[A5629]

A5629
hg38 Position: ChrY:16494520..16494520
Ancestral: C
Derived: T
Reference: YSEQ (2015)
ISOGG Haplogroup: R1b1a2a1a2c1e
Comments: Downstream Z16438
Forward Primer: A5629_F AACAGAAATAAATTCCCATAGATGTATGA
Reverse Primer: A5629_R AACAAGATTATGTCCTTTTCACAAATC
Reviews

Customers who bought this product also purchased
FGC33232
FGC33232
Z16437
Z16437
FGC33228
FGC33228
Z16434
Z16434
A5631
A5631
Z16433
Z16433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies