Top » Catalog » SNPs » A5629

$18.00

A5629
[A5629]

A5629
hg38 Position: ChrY:16494520..16494520
Ancestral: C
Derived: T
Reference: YSEQ (2015)
ISOGG Haplogroup: R1b1a2a1a2c1e
Comments: Downstream Z16438
Forward Primer: A5629_F AACAGAAATAAATTCCCATAGATGTATGA
Reverse Primer: A5629_R AACAAGATTATGTCCTTTTCACAAATC
Reviews

Customers who bought this product also purchased
A557
A557
R1b-Z255 Panel
R1b-Z255 Panel
Z16438
Z16438
FGC33232
FGC33232
Z16437
Z16437
FGC33228
FGC33228
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies