Top » Catalog » SNPs » FGC4316

$18.00

FGC4316
[FGC4316]

FGC4316
hg38 Position: ChrY:16587496..16587496
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC9
Forward Primer: FGC4316_F CTCATTTTCAGGTTTTCAGTAAAGC
Reverse Primer: FGC4316_R CTCACTTTCCATTAAACTGACTGC
Reviews

Customers who bought this product also purchased
FGC7936
FGC7936
ZS11060
ZS11060
FGC7
FGC7
ZS4756
ZS4756
FGC5
FGC5
ZS4755
ZS4755
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies