Top » Catalog » SNPs » FGC4316

$18.00

FGC4316
[FGC4316]

FGC4316
hg38 Position: ChrY:16587496..16587496
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC9
Forward Primer: FGC4316_F CTCATTTTCAGGTTTTCAGTAAAGC
Reverse Primer: FGC4316_R CTCACTTTCCATTAAACTGACTGC
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
FGC10095
FGC10095
FGC38809
FGC38809
FGC1707
FGC1707
FGC4309
FGC4309
ZS8266
ZS8266
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies