Top » Catalog » SNPs » FGC4316

$18.00

FGC4316
[FGC4316]

FGC4316
hg38 Position: ChrY:16587496..16587496
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC9
Forward Primer: FGC4316_F CTCATTTTCAGGTTTTCAGTAAAGC
Reverse Primer: FGC4316_R CTCACTTTCCATTAAACTGACTGC
Reviews

Customers who bought this product also purchased
Z20773
Z20773
ZS10531
ZS10531
Z20775
Z20775
ZS9598
ZS9598
FGC2
FGC2
Z20778
Z20778
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies