Top » Catalog » SNPs » V22

$18.00

V22
[V22]

V22
hg38 Position: ChrY:6991916..6991916
Ancestral: T
Derived: C
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b2
Comments: TBL1Y
Forward Primer: V22v2_F GTGGGCCTATGAAACTCACC
Reverse Primer: V22v2_R AGAGCAAACTTACGCACATGG
Reviews

Customers who bought this product also purchased
Y17362
Y17362
CTS6664
CTS6664
Z1252
Z1252
CTS491
CTS491
V6
V6
CTS1620
CTS1620
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies