Top » Catalog » SNPs » V22

$18.00

V22
[V22]

V22
hg38 Position: ChrY:6991916..6991916
Ancestral: T
Derived: C
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b2
Comments: TBL1Y
Forward Primer: V22v2_F GTGGGCCTATGAAACTCACC
Reverse Primer: V22v2_R AGAGCAAACTTACGCACATGG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
CTS9792
CTS9792
E1a-M132 Panel
E1a-M132 Panel
Z5991
Z5991
Z15301
Z15301
M191
M191
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies