Top » Catalog » SNPs » V22

$18.00

V22
[V22]

V22
hg38 Position: ChrY:6991916..6991916
Ancestral: T
Derived: C
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b2
Comments: TBL1Y
Forward Primer: V22v2_F GTGGGCCTATGAAACTCACC
Reverse Primer: V22v2_R AGAGCAAACTTACGCACATGG
Reviews

Customers who bought this product also purchased
Y22762
Y22762
PF2022
PF2022
CTS4483
CTS4483
V32
V32
Z809
Z809
Z814
Z814
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies