Top » Catalog » SNPs » V22

$18.00

V22
[V22]

V22
hg38 Position: ChrY:6991916..6991916
Ancestral: T
Derived: C
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b2
Comments: TBL1Y
Forward Primer: V22v2_F GTGGGCCTATGAAACTCACC
Reverse Primer: V22v2_R AGAGCAAACTTACGCACATGG
Reviews

Customers who bought this product also purchased
M5012
M5012
Y77724
Y77724
M4992
M4992
Y6198
Y6198
P68
P68
Y19896
Y19896
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies