Top » Catalog » SNPs » V22

$18.00

V22
[V22]

V22
hg38 Position: ChrY:6991916..6991916
Ancestral: T
Derived: C
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b2
Comments: TBL1Y
Forward Primer: V22v2_F GTGGGCCTATGAAACTCACC
Reverse Primer: V22v2_R AGAGCAAACTTACGCACATGG
Reviews

Customers who bought this product also purchased
CTS6080
CTS6080
CTS567
CTS567
BY7446
BY7446
FGC2739
FGC2739
CTS9334
CTS9334
M5012
M5012
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies