Top » Catalog » SNPs » FGC48144

$18.00

FGC48144
[FGC48144]

FGC48144
hg38 Position: ChrY:13091662..13091662
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48144_F CACTCTTTCACTTAGGCCAATTTG
Reverse Primer: FGC48144_R TGAAGTTGGATTGCACAATTTAAC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5235
$18.00
Haplogroup Info
Other products
Currencies