Top » Catalog » SNPs » FGC48146

$18.00

FGC48146
[FGC48146]

FGC48146
hg38 Position: ChrY:13788174..13788174
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48146_F GGAAACAGCCTAGTTGATCAATG
Reverse Primer: FGC48146_R CATCCTGGACTCAACTTGAGG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies