Top » Catalog » SNPs » FGC48149

$18.00

FGC48149
[FGC48149]

FGC48149
hg38 Position: ChrY:15782411..15782411
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48149_F GAAAGAGAATTATTGCAACTTTTGG
Reverse Primer: FGC48149_R CATGGGGAGGACACTAATCTG
Reviews

Customers who bought this product also purchased
FGC48144
FGC48144
FGC48136
FGC48136
FGC48148
FGC48148
FGC48156
FGC48156
J1a-FGC48136 Segregation Panel
J1a-FGC48136 Segregation Panel
FGC48147
FGC48147
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies