Top » Catalog » SNPs » FGC48149

$18.00

FGC48149
[FGC48149]

FGC48149
hg38 Position: ChrY:15782411..15782411
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48149_F GAAAGAGAATTATTGCAACTTTTGG
Reverse Primer: FGC48149_R CATGGGGAGGACACTAATCTG
Reviews

Customers who bought this product also purchased
FGC48145
FGC48145
FGC48151
FGC48151
FGC48143
FGC48143
FGC48150
FGC48150
FGC48144
FGC48144
FGC48136
FGC48136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies