Top » Catalog » SNPs » FGC48150

$18.00

FGC48150
[FGC48150]

FGC48150
hg38 Position: ChrY:16566193..16566193
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48150_F GTCCCTGATTCCTGTAAGCC
Reverse Primer: FGC48150_R TGAGACCCGAATTATGTATGCTG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies