Top » Catalog » SNPs » FGC48151

$18.00

FGC48151
[FGC48151]

FGC48151
hg38 Position: ChrY:17010165..17010165
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48151_F GCATGACATCGGCTCACC
Reverse Primer: FGC48151_R CTGAGTGAGACCATGGAATATTG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies