Top » Catalog » SNPs » FGC48153

$18.00

FGC48153
[FGC48153]

FGC48153
hg38 Position: ChrY:19459968..19459968
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48153_F CAAATCTCAATAACCTGGTCTCC
Reverse Primer: FGC48153_R TGTCATTTGATCATGGGTCAG
Reviews

Customers who bought this product also purchased
J1-FGC48136 Shawahnet El Aqiq Panel
J1-FGC48136 Shawahnet El Aqiq Panel
FGC48143
FGC48143
FGC48149
FGC48149
FGC48144
FGC48144
FGC48136
FGC48136
FGC48148
FGC48148
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies