Top » Catalog » SNPs » FGC48156

$18.00

FGC48156
[FGC48156]

FGC48156
hg38 Position: ChrY:20817427..20817427
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48156_F ACAGACATCCATGACAGATTCG
Reverse Primer: FGC48156_R TTGGCCATCTTCCTGATTTG
Reviews

Customers who bought this product also purchased
FGC48146
FGC48146
FGC48151
FGC48151
FGC48145
FGC48145
FGC48150
FGC48150
FGC48143
FGC48143
FGC48149
FGC48149
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies