Top » Catalog » SNPs » A11846

$18.00

A11846
[A11846]

A11846
HG19 Position: ChrY:7212096..7212096
Ancestral: A
Derived: G
Reference: Aaron Wright (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF49 > A260
Forward Primer: A11846_F CCCTGTCTATCTCTATGGTCTACCTC
Reverse Primer: A11846_R GATAGATGTTTGATAGCCAGACAGAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies