Top » Catalog » SNPs » YP4549

$18.00

YP4549
[YP4549]

YP4549
hg38 Position: ChrY:19300256..19300256
Ancestral: G
Derived: A
Reference: YDNA-community (2015)
ISOGG Haplogroup: Q1a2a1c1 (not listed)
Comments: Below L334 > YP779 > L332 > YP1695 > L333
Forward Primer: YP4549_F CGCTGGAGTTAAGGATGTGC
Reverse Primer: YP4549_R GGACCCCAAACTCATTAGCC
Reviews

Customers who bought this product also purchased
Q1b-L53 Panel
Q1b-L53 Panel
Y31277
Y31277
YP4560
YP4560
YP1695
YP1695
SK1942
SK1942
L334
L334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies