Top » Catalog » Y SNPs » ZS11269

$18.00

ZS11269
[ZS11269]

ZS11269
hg38 Position: ChrY:6557650..6557650
Ancestral: A
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: Downstream FGC2
Forward Primer: ZS11269_F AAAGCCAAAAGGGACTGCTC
Reverse Primer: ZS11269_R TCCTAGGATTTCTGTTTGGTTC
Reviews

Customers who bought this product also purchased
L858
L858
FGC5
FGC5
FT293359
FT293359
FGC11
FGC11
FGC7
FGC7
FT205660
FT205660
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies