Top » Catalog » SNPs » ZS11269

$19.00

ZS11269
[ZS11269]

ZS11269
hg38 Position: ChrY:6557650..6557650
Ancestral: A
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: Downstream FGC2
Forward Primer: ZS11269_F AAAGCCAAAAGGGACTGCTC
Reverse Primer: ZS11269_R TCCTAGGATTTCTGTTTGGTTC
Reviews

Customers who bought this product also purchased
Y416860
Y416860
Y337898
Y337898
A27207
A27207
Y33889
Y33889
BY4
BY4
Y198994
Y198994
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies