Top » Catalog » SNPs » A13324

$18.00

A13324
[A13324]

A13324
hg38 Position: ChrY:7778752..7778752
Ancestral: T
Derived: C
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A13324_F TCTTTTCTACAGATCCATTGTGTG
Reverse Primer: A13324_R TTTCCACTGACAATAGCCACAG
Reviews

Customers who bought this product also purchased
A10327
A10327
A10326
A10326
A10325
A10325
A10330
A10330
A10329
A10329
A10328
A10328
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies