Top » Catalog » SNPs » A13597

$18.00

A13597
[A13597]

A13597
hg38 Position: ChrY:8898714..8898714
Ancestral: C
Derived: T
Reference: Kudryashov Vinogradov (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A13597_F GGGTTTAAATTTAACATATTTTCTTAAGGATAG
Reverse Primer: A13597_R TATATTTATCATTTAGGCATATGCAGTATACTC
Reviews

Customers who bought this product also purchased
Z2103
Z2103
CTS9219
CTS9219
Y30217
Y30217
Z2106
Z2106
BY3716
BY3716
FGC14589
FGC14589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies