Top » Catalog » SNPs » A13597

$18.00

A13597
[A13597]

A13597
hg38 Position: ChrY:8898714..8898714
Ancestral: C
Derived: T
Reference: Kudryashov Vinogradov (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A13597_F GGGTTTAAATTTAACATATTTTCTTAAGGATAG
Reverse Primer: A13597_R TATATTTATCATTTAGGCATATGCAGTATACTC
Reviews

Customers who bought this product also purchased
M12135
M12135
R1b-Z2103 Panel
R1b-Z2103 Panel
A366
A366
Z2103
Z2103
CTS9219
CTS9219
Y30217
Y30217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies