Top » Catalog » SNPs » S18765

$18.00

S18765
[S18765]

S18765
hg38 Position: ChrY:14655142..14655142
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: G2a2b2a1a1b1a2a1a2
Comments: Below M201_L497_CTS4803_S2808_S23438_S18765
Forward Primer: S18765_F CTCCTTCCTTGCAGAAATACG
Reverse Primer: S18765_R AGAAGTTCCCAGGATGAGAGG
Reviews

Customers who bought this product also purchased
Z17780
Z17780
Z30739
Z30739
FGC14522
FGC14522
Z45473
Z45473
Z725
Z725
Y3101
Y3101
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies