Top » Catalog » SNPs » Z39695

$18.00

Z39695
[Z39695]

Z39695
hg38 Position: ChrY:8514747..8514747
Ancestral: G
Derived: A
Reference: Ray Banks (2016)
ISOGG Haplogroup: G
Comments: Subgrp under Z39670
Forward Primer: Z39695_F CTCCTCCCTCTCCATTTGTG
Reverse Primer: Z39695_R TTTTTCATGATGGGGGAAAG
Reviews

Customers who bought this product also purchased
FGC1705
FGC1705
Y106708
Y106708
FGC1696
FGC1696
Y85182
Y85182
FGC1713
FGC1713
ZS8514
ZS8514
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies