Top » Catalog » SNPs » Z39695

$18.00

Z39695
[Z39695]

Z39695
hg38 Position: ChrY:8514747..8514747
Ancestral: G
Derived: A
Reference: Ray Banks (2016)
ISOGG Haplogroup: G
Comments: Subgrp under Z39670
Forward Primer: Z39695_F CTCCTCCCTCTCCATTTGTG
Reverse Primer: Z39695_R TTTTTCATGATGGGGGAAAG
Reviews

Customers who bought this product also purchased
FGC5
FGC5
ZS8508
ZS8508
FGC1707
FGC1707
FGC4453
FGC4453
BY120927
BY120927
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies