Top » Catalog » SNPs » A13633

$18.00

A13633
[A13633]

A13633
hg38 Position: ChrY:14156024..14156024
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13633_F TGTCCCTATGGGGTGATTTG
Reverse Primer: A13633_R ACTGTTGGCACATGAAGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15598
1 x HU206
$36.00
Haplogroup Info
Other products
Currencies