Top » Catalog » SNPs » A13637

$18.00

A13637
[A13637]

A13637
hg38 Position: ChrY:20658654..20658654
Ancestral: C
Derived: A
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13637_F CAGCATTCCCAAGTTGAAGG
Reverse Primer: A13637_R CAGTGGGTCTGAGGGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies