Top » Catalog » SNPs » A13638

$18.00

A13638
[A13638]

A13638
hg38 Position: ChrY:8992399..8992399
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13638_F AAAATGGTGGCACAGTGATG
Reverse Primer: A13638_R CCTTTCTGGAGCAAATGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH2651
$18.00
Haplogroup Info
Other products
Currencies