Top » Catalog » SNPs » A13639

$18.00

A13639
[A13639]

A13639
hg38 Position: ChrY:11686085..11686085
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13639_F CTGGAACAAAACGGAAATTAAC
Reverse Primer: A13639_R TTCCATTCATGTCAATCACG
Reviews

Customers who bought this product also purchased
Y19869
Y19869
A13641
A13641
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y13511
$18.00
Haplogroup Info
Other products
Currencies