Top » Catalog » SNPs » A13641

$18.00

A13641
[A13641]

A13641
hg38 Position: ChrY:14995895..14995895
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13641_F TGTCCATACAAGCAATCACTCC
Reverse Primer: A13641_R CCCCACTGAGCCACATAAG
Reviews

Customers who bought this product also purchased
Y19869
Y19869
A13639
A13639
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies