Top » Catalog » SNPs » FGC28370

$18.00

FGC28370
[FGC28370]

FGC28370
hg38 Position: ChrY:7663000..7663000
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC28370_F GTGCTAGCATATTTTATCTGAAGGCA
Reverse Primer: FGC28370_R AGGTGTGAACCAAAATGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies