Top » Catalog » SNPs » BY3927

$18.00

BY3927
[BY3927]

BY3927
hg38 Position: ChrY:19132662..19132662
Ancestral: G
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R
Comments: Downstream of CTS1751
Forward Primer: BY3927_F TGACCCTTGCCTTCTAGGTC
Reverse Primer: BY3927_R CGGGTCATATCCTGATGGAG
Reviews

Customers who bought this product also purchased
DF13
DF13
FGC33712
FGC33712
S1051
S1051
Z17969
Z17969
L21
L21
DF63
DF63
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies