Top » Catalog » SNPs » BY3927

$18.00

BY3927
[BY3927]

BY3927
hg38 Position: ChrY:19132662..19132662
Ancestral: G
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R
Comments: Downstream of CTS1751
Forward Primer: BY3927_F TGACCCTTGCCTTCTAGGTC
Reverse Primer: BY3927_R CGGGTCATATCCTGATGGAG
Reviews

Customers who bought this product also purchased
Z39589
Z39589
S16264
S16264
DF41
DF41
BY54624
BY54624
R1b-DF27 Panel
R1b-DF27 Panel
Z16500
Z16500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies