Top » Catalog » SNPs » BY3927

$18.00

BY3927
[BY3927]

BY3927
hg38 Position: ChrY:19132662..19132662
Ancestral: G
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R
Comments: Downstream of CTS1751
Forward Primer: BY3927_F TGACCCTTGCCTTCTAGGTC
Reverse Primer: BY3927_R CGGGTCATATCCTGATGGAG
Reviews

Customers who bought this product also purchased
DF63
DF63
FGC13780
FGC13780
Z251
Z251
DF27
DF27
FGC10059
FGC10059
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies